JOURNAL OF f i f t e e n d o l l a r s Environmental Health Published by the National Environmental Health Association www.neha.org Dedicated to the advancement of the environmental health professional Volume 85, No. 5 December 2022
December 2022 • our1al o) E18,ro1me1tal Healt+ 3 ADVANCEMENT OF THE SCIENCE Microbial Source Tracking in the Sasco Brook, Lower Farm River, and Goodwives River Watersheds of Long Island Sound ..................................................................................... 8 Special Report: Biological Factors That Impact Variability of Lead Absorption and Blood Lead Level Estimation in Children: Implications for Child Blood Lead Level Testing Practices ................................................................................................................ 18 Special Report/International Perspectives: Brownfields in Romania and the United States: A Visual Tour ....................................................................................................... 28 ADVANCEMENT OF THE PRACTICE Direct From AAS: The Ethics of Professionalism in Environmental Health .................................. 40 Direct From CDC/Environmental Health Services: Using E ective Communication Strategies to Help Teens Manage Stress After Natural Disasters ................................................... 44 Direct From U.S. EPA/ORD: Science and Science-Based Tools to Address Persistent Hazardous Exposures to Lead ...................................................................................................... 46 ADVANCEMENT OF THE PRACTITIONER Environmental Health Calendar ............................................................................................... 50 Resource Corner........................................................................................................................ 51 JEH Quiz #3............................................................................................................................... 52 YOUR ASSOCIATION President’s Message: The Happiest Profession on Earth ...........................................................................6 Special Listing ........................................................................................................................... 54 A Tribute to 2022 JEH Peer Reviewers....................................................................................... 56 In Memoriam............................................................................................................................. 58 NEHA News .............................................................................................................................. 60 NEHA 2023 AEC....................................................................................................................... 64 DirecTalk: Manasota Beach ........................................................................................................ 66 JOURNAL OF Environmental Health Dedicated to the advancement of the environmental health professional Volume 85 No 5 December A B O U T T H E C O V E R Shortcomings in traditional methods to understanding sources of bacterial contamination in water bodies limit the ability of public health ocials to adequately protect public health and mitigate pollution sources. This month’s cover article, “Microbial Source Tracking in the Sasco Brook, Lower Farm River, and Goodwives River Watersheds of Long Island Sound,” used polymerase chain reaction (PCR) as a tool for microbial source tracking to attempt to identify host species contributing bacteria to three watersheds that flow into Long Island Sound. While the study had limitations and further research is needed, DNA analysis can be an eective public health tool toward bacterial source identification that can aid in determining if source bacteria are a potential threat to public health and to guide remediation eorts. See page 8. Cover images © iStockphoto: KenWiedemann, deliormanli, Lubo Ivanko A D V E R T I S E R S I N D E X American Public Health Association.................... 27 EMSL Analytical, Inc............................................ 67 HS GovTech (Formerly HealthSpace) .................. 68 Inspect2GO Environmental Health Software ......... 2 NEHA-FDA Retail Flexible Funding Model Grant Program ............................................ 5 Ozark River Manufacturing Co. ........................... 17 Private Well Class................................................... 5
4 Volume 85 • Number 5 in the next Journal of Environmental Health don’t miss Of f i c i a l Pub l i ca t i on Journal of Environmental Health (ISSN 0022-0892) Kristen Ruby-Cisneros, Managing Editor Ellen Kuwana, MS, Copy Editor Hughes design|communications, Design/Production Cognition Studio, Cover Artwork Soni Fink, Advertising For advertising call (303) 802-2139 Technical Editors William A. Adler, MPH, RS Retired (Minnesota Department of Health), Rochester, MN Gary Erbeck, MPH Retired (County of San Diego Department of Environmental Health), San Diego, CA Thomas H. Hatfield, DrPH, REHS, DAAS California State University, Northridge, CA Dhitinut Ratnapradipa, PhD, MCHES Creighton University, Omaha, NE Published monthly (except bimonthly in January/February and July/ August) by the National Environmental Health Association, 720 S. Colorado Blvd., Suite 105A, Denver, CO 80246-1910. Phone: (303) 8022200; Fax: (303) 691-9490; Internet: www.neha.org. E-mail: kruby@ neha.org. Volume 85, Number 5. Yearly subscription rates in U.S.: $150 (electronic), $160 (print), and $185 (electronic and print). Yearly international subscription rates: $150 (electronic), $200 (print), and $225 (electronic and print). Single copies: $15, if available. Reprint and advertising rates available at www.neha.org/jeh. Claims must be filed within 30 days domestic, 90 days foreign, © Copyright 2022, National Environmental Health Association (no refunds). All rights reserved. Contents may be reproduced only with permission of the managing editor. Opinions and conclusions expressed in articles, columns, and other contributions are those of the authors only and do not reflect the policies or views of NEHA. NEHA and the Journal of Environmental Health are not liable or responsible for the accuracy of, or actions taken on the basis of, any information stated herein. NEHA and theJournal of Environmental Health reserve the right to reject any advertising copy. Advertisers and their agencies will assume liability for the content of all advertisements printed and also assume responsibility for any claims arising therefrom against the publisher. The Journal of Environmental Health is indexed by Clarivate, EBSCO (Applied Science & Technology Index), Elsevier (Current Awareness in Biological Sciences), Gale Cengage, and ProQuest. The Journal of Environmental Health is archived by JSTOR (www.jstor.org/journal/ jenviheal). All technical manuscripts submitted for publication are subject to peer review. Contact the managing editor for Instructions for Authors, or visit www.neha.org/jeh. To submit a manuscript, visit http://jeh.msubmit.net. Direct all questions to Kristen Ruby-Cisneros, managing editor, kruby@neha.org. Periodicals postage paid at Denver, Colorado, and additional mailing offices. POSTMASTER: Send address changes to Journal of Environmental Health, 720 S. Colorado Blvd., Suite 105A, Denver, CO 80246-1910. Printed on recycled paper. Critical Competencies in Children’s Environmental Health Effect of Lockdown on the Air Quality of Four Major Cities in Pakistan During the COVID-19 Pandemic Role of the Household Environment in Transmission of Clostridioides difficile Infection Join our environmental health community. It is the only community of people who truly understand what it means to do what you do every day to protect the health of our communities. Join us today. Your people are waiting. neha.org/membership Find Your People. Find Your Training. Find Your Resources.
December 2022 • Journal of Environmental Health 5 Private Well Class is a collaboration between the Rural Community Assistance Partnership and the Illinois State Water Survey and funded by the U.S. Environmental Protection Agency. Help your community by taking this course and sharing what you learn with residents who use private wells. Topics include well contamination, construction, maintenance, emergencies, testing, and more. Free. Earn up to 10 continuing education contact hours upon completion. register today: www.neha.org/private-well-class You are here. In just 10 minutes, you can help transform the future of food safety. Your input will help us untangle the workforce needs of the retail food safety regulatory community. Take the survey neha.org/retail-grants-needs-assessment
6 Volume 85 • Number 5 YOUR ASSOCIATION D. Gary Brown, DrPH, CIH, RS, DAAS The Happiest Profession on Earth PRES I DENT ’ S MESSAGE As I look back on the past year, words cannot express how grateful I am to be a part of this wild and wonderful environmental health field. Just like Henry David Thoreau said, “I am grateful for what I am and have. My thanksgiving is perpetual.” Over the past several years, environmental health professionals have been the unsung heroes of the COVID-19 pandemic. You have done as Abraham Lincoln said, “I do the very best I know how—the very best I can; and I mean to keep on doing so until the end.” In this holiday season, we all have much to celebrate regarding environmental health along with the success of the National Environmental Health Association (NEHA). I want to extend my personal thanks to environmental health professionals, NEHA partners, students, and NEHA sta, regional vice-presidents, and board members. As I stated in a previous column, we all are thankful for the ability to meet in person once again. I have been fortunate enough to attend several conferences that have allowed me to meet my fellow environmental health professionals and to learn new information. No matter what stage of our careers we are at, all environmental health professionals have unique knowledge and experiences. Environmental health professionals love to learn from each other because we have a shared passion. I am thankful to be a part of a dynamic and constantly evolving field. When I started in the field 30 years ago, indoor air quality, emergency response, per- and polyfluoroalkyl substances (PFAS), nanomaterials, cyanobacteria (i.e., blue-green algae) blooms, and climate change were barely a blip on the radar, if on our radar at all. Learning about these areas along with other emerging challenges keeps me excited, engaged, and entertained. Over the past several months I had the pleasure to attend the Yankee Conference in New England, the Canadian Institute of Public Health Inspectors National Conference, and the Jamaica Association of Public Health Inspectors Annual Educational Conference. Over the years I have learned that no matter where we hail from—even from a galaxy far, far away—we all speak the same environmental health language. Foundational principles of environmental health apply anywhere, irrespective of nuances in regulations. Unlike many other professions, another magnificent aspect of our profession is the willingness and happiness to share information regarding similar challenges. In many professions, such as engineering, the free sharing of ideas is hindered by the fear of losing a competitive advantage. Environmental health professionals want to ensure people have a safe and healthy place in which to live, work, and play. I am extremely grateful to have the privilege to teach this wild and wonderful environmental health field to future professionals. As Bob Phillips stated, “There are three stages of man: he believes in Santa Claus; he does not believe in Santa Claus; he is Santa Claus.” Even though I am the Santa Claus (I still believe) of the Environmental Health Science Department at Eastern Kentucky University (EKU), my colleagues and the students help to keep me young at heart by educating me on new things. Today, students and early career professionals want a fulfilling career to help people and to make the world a better place. For younger individuals, environmental health checks o all of those career boxes along with many others. As our EKU students say, the Environmental Health Science Department is the “happiest department on campus,” not quite up to Disneyland’s “The Happiest Place on Earth.” Another slogan for environmental health could be the “happiest profession on Earth.” Please volunteer to share the joy because all of the National Environmental Health Science and Protection Accreditation Council (EHAC) environmental health programs would love to have more environmental health professionals involved with and engaged in these programs. Let us all work to empower students for a bright future in a career with endless possibilities. EHAC is the gold standard regarding environmental health science accreditation. EHAC requires a firm educational foundation in the natural sciences of biology, microbiology, chemistry, and physics. This Environmental health professionals love to learn from each other because we have a shared passion.
December 2022 • Journal of Environmental Health 7 foundation—combined with a requirement for the completion of a practical, hands-on internship—results in graduates that are well prepared to immediately enter the environmental health workforce or to continue their academic journeys. Many environmental health professionals may not know that graduation from an EHAC-accredited program is required to enter U.S. Public Health Service, U.S. Army, and U.S. Navy environmental science and engineering careers. Graduates of EHAC-accredited programs meet the criteria to take the NEHA Registered Environmental Health Specialist/ Registered Sanitarian (REHS/RS) credential examination after graduation. Please reach out to a program in your area. I know you will enjoy your time at your local college or university’s “happiest department on campus” while sharing your experience about the “happiest profession on Earth.” If there are no EHAC-accredited program in your area, there are local colleges or universities that may be interested in starting an environmental health science program. Further, please reach out to the Association of Environmental Health Academic Programs (AEHAP). We need more environmental health science programs at the undergraduate and graduate levels both nationally and internationally. There are more jobs than graduates, which results in countless jobs being filled by those not possessing an environmental health science degree. Unlike many other fields, even if the number of environmental health science programs doubled or tripled and the number of graduates quadrupled or quintupled—which would be a wonderful thing—there would still be an abundance of jobs filled by those not possessing an environmental health science degree. I want to provide a little background about an unsung organization in our field: AEHAP. In 1999, AEHAP volunteers and a small sta began working alongside EHAC volunteers to promote the value of environmental health education and degrees. The goal was to launch more environmental health professionals into careers of significance for the care, health, and protection of our communities. From then to now, the goal remains to encourage more students to pursue a science-based degree in environmental health. AEHAP and EHAC would love to have more environmental health professional involved—the more the merrier. Hopefully, we will be able to enjoy some well-deserved time o during these holidays. I wish all of you the very best, along with health and happiness throughout the coming year. A little more sparkle, a little less stress. As environmental health science rings in the New Year, I leave you with a quote from David Bowie: “I don’t know where I’m going from here, but I promise it won’t be boring.” gary.brown@eku.edu The food industry moves fast. The Certified Professional–Food Safety (CP-FS) credential keeps you up-todate with the rapidly changing food industry and tells your community that you know the science and practice to keep them safe. neha.org/credentials Membership provides environmental health professionals with connection, education, and advancement in their careers. Our nationally recognized credentials, extensive learning opportunities, and community of dedicated leaders position our members for greater professional success. We believe that the success of our members elevates the entire environmental health profession. We o er several di erent membership options: Professional, Emerging Professional, Retired Professional, International, and Life. Learn more about membership and its benefits at www.neha.org/membership. Did You Know?
8 Volume 85 • Number 5 A D VANC EME N T O F T H E SCIENCE Introduction The presence of fecal matter is a cause of water body impairment in the U.S. and globally. Fecal contamination poses public health risks associated with pathogens (Cabral, 2010; Wade et al., 2010) as well as other concerns such as excess nutrients leading to eutrophication (Pinckney et al., 2001). Water bodies often are declared closed when impairment is suspected, causing loss of access by both recreational and commercial users, thereby resulting in economic damages in the community (Rabinovici et al., 2004). While proxy measures associated with impairment (e.g., rainfall amount) often are used for such closures, a common means to trigger the closure of water bodies is the detection of fecal indicator bacteria (FIB) such as E. coli or enterococci that are found primarily or exclusively in feces, which can be easily quantified. Although monitoring for FIB has been used to assess water quality for decades, there are many limitations of this method, including a poor correlation with health risks (Colford et al., 2007) and a lack of information regarding the source of the contamination. While point sources of fecal contamination have been addressed largely through improved infrastructure, sites that continue having elevated bacterial counts (possibly due to fecal contamination) experience contribution from numerous and dicult-to-identify nonpoint sources of fecal matter or bacteria. An important first step in the process of source identification is the ability to identify the species contributing to elevated FIB counts. Source identification is particularly relevant at the watershed scale where numerous sources likely contribute to contamination. Without being able to quickly identify fecal contamination sources via testing, water quality managers rely on time-consuming and costly surveys that are often unsuccessful at identifying the sources. Additionally, unknown sources limit the ability for mitigation and risk assessment in watersheds that experience contamination. Our project design was an attempt to remove proxy measures used to make public health decisions and use DNA source tracking to determine the sources of bacteria as a means of assessing risk levels. To address the limitations of traditional FIB monitoring, a microbial source tracking toolbox has been developed that includes a range of methodologies (Scott et al., 2002). One promising option within this toolbox is the amplification of selected DNA fragments via polymerase chain reaction (PCR). PCR can be used to amplify a variety of markers including those found in fecal pathogens (Harwood et al., 2014; Korajkic et al., 2018) or the same FIB traditionally used for culture-based detection (Chern et al., 2011; Haugland et al., 2010; Kildare et al., 2007). By targeting genetic markers within the bacteria that are specific to a given host (i.e., Abs t r ac t Shortcomings in traditional methods for understanding sources of bacteriological contamination limit the ability of public health o cials to adequately protect public health and mitigate pollution sources. This study used polymerase chain reaction (PCR) as a tool for microbial source tracking to attempt to identify host species contributing bacteria to three watersheds flowing into Long Island Sound. Samples were collected once a month near the mouth of each watershed and analyzed for other E. coli (a traditional fecal indicator) and genetic markers for members of the phylum Bacteroidetes. Genetic markers included host-specific markers that can be used to identify sources of contamination such as humans, domestic animals, and wildlife. Despite observing elevated E. coli levels in all three watersheds, we could not make a conclusive determination of actual sources using the available tools. Additionally, as there was disagreement between the E. coli levels and the presence of the general Bacteroidetes marker, it is important to evaluate the accuracy of this indicator with respect to recent fecal contamination and human health risks. Limitations posed by using indicator organisms, such as enterococci, illustrate the need to develop other methodologies for assessing actual sources of bacterial contamination. Microbial Source Tracking in the Sasco Brook, Lower Farm River, and Goodwives River Watersheds of Long Island Sound Lauren Brooks, PhD Biology Department, Utah Valley University Adalgisa Caccone, PhD Department of Ecology and Evolutionary Biology, Yale University Mark Cooper, MPH, RS Westport–Weston Health District David Knauf, MPH, MS, REHS Health Department, Town of Darien Michael A. Pascucilla, MPH, REHS, DAAS East Shore District Health Department
December 2022 • Journal of Environmental Health 9 host-specific genetic markers), it is possible to identify species that contribute to fecal contamination in a body of water (Bernhard & Field, 2000). This approach could provide water quality managers with possible contamination sources, which is a valuable starting point to begin source tracking and eventual mitigation in a targeted way. In our study, three local health departments in Connecticut collaborated to use host-specific genetic markers to provide information on possible contamination sources in three watersheds in coastal Connecticut. All three selected watersheds outlet into the Long Island Sound (LIS), an Atlantic Ocean tidal estuary that the U.S. Congress declared to be of national significance. Water quality in LIS is threatened by localized urbanization and the >9 million people who live within the watershed area (Save the Sound, 2022). The LIS estuary has been the focus of many remediation eorts (Schimmel et al., 1999; State of Connecticut, 2020), yet still experiences frequent elevated fecal bacteria counts, especially after rainfall events. By analyzing water samples from each watershed, we attempted to identify the sources of bacteria, evaluate the actual risk the bacteria pose to public health, better understand fluctuations in bacterial counts aecting the water quality of LIS, and establish mitigation programs based on these results. Methods Watershed Selection The Sasco Brook (Westport), Lower Farm River (Branford), and Goodwives River (Darien) watersheds (Figure 1) all have experienced unexplained elevated bacterial counts that were especially pronounced after precipitation events. Both Sasco Brook and Goodwives River have been identified by the Connecticut Department of Energy and Environmental Protection (CT DEEP; State of Connecticut, 2019) as impaired water bodies for not meeting state water quality standards for fecal coliform bacteria (i.e., a class of FIB that includes E. coli). The Lower Farm River site has also experienced elevated FIB levels and is of special interest because of recreational and commercial shellfishing. As all three watersheds feed into LIS, addressing impairments in water quality at these sites may also help to alleviate pressures on this estuary of national significance. Standardized Sample Collection, Processing, and Monitoring of Traditional Fecal Indicator Bacteria Sampling locations were selected near the mouth of each watershed. Water samples were collected once a month between January and December 2016 at low or ebbing tides to avoid tidal influence. For each sample, approximately 500 ml of water was collected in a sterile container from between 6 and 12 in. below the surface of the water. Samples were placed in an insulated cooler on ice for transport to the Harbor Watch Laboratory in Westport, Connecticut. E. coli enumeration was conducted at the Harbor Watch Laboratory using m-FC media following standard method 9222D (National Environmental Methods Index, n.d.). Individual CFUs were counted to estimate bacterial abundance in the water samples. For the genetic analysis, two independent 100-ml water subsamples were vacuum filtered on a 0.2-μm pore size polycarbonate filter (GE Osmotic 04CP04700) to concentrate bacterial cells. Following filtration, the filter was removed aseptically and placed into cryo-safe tubes with glass beads or in a sterile polypropylene tube with a screw cap. These filters were stored at -80 °C in the Connecticut Agricultural Experiment Station (CAES). DNA extractions were conducted on the first set of filters at CAES as previously described (Shanks et al., 2016). Analysis With qPCR Analysis for host-specific genetic markers was conducted at the Center for Genetic Analyses of Biodiversity in the Yale Institute for Biospheric Studies. Quantitative PCR (qPCR) was used (ABI 7500 Fast Real-Time PCR) to amplify all markers using either SYBR Green or TaqMan chemistry (Table 1). TaqMan reactions were a total volume of 20 μl consisting of 10 μl of TaqMan Fast Universal Master Mix (ThermoFisher 4352042), 500 nmol/l of each primer, and 250 nmol/l of probe. SYBR Green assays were conducted similarly, with 20 μl reactions consisting of Map of Connecticut Showing the Location of the Three Targeted Watersheds FIGURE 1 Goodwives River, Darien Sasco Brook, Westport Lower Farm River, Branford
10 Volume 85 • Number 5 A D VANC EME N T O F T H E SCIENCE 10 μl of Fast SYBR Green Master Mix (ThermoFisher 4309155) and 500 nmol/l of each primer. All reactions were performed in triplicate in MicroAmp optical 96-well plates with optical adhesive film. Cycling parameters included a 2-min start at 94 °C followed by 40 cycles of 15 s at 94 °C and 32 s at 60 °C. Cycle threshold for each run was determined by the instrument software. Standards were constructed for each plate using synthetic plasmids consisting of sequences corresponding to the selected markers (Supplemental Table 1, www.neha.org/jehsupplementals). Standards were diluted from a range of 105 to 101 markers per reaction and used to construct calibration curves for quantification for each run. Troubleshooting to achieve amplification of the two SYBR Green assays was performed to reach specific and reliable amplification. These optimization steps included variations in melting temperature, magnesium chloride, and PCR additives such as bovine serum albumin. Quality Assurance and Controls For each round of sampling, one negative control filtration blank (i.e., sterile water known to contain no FIB or genetic markers) was processed following the same protocol as described above to detect contamination in the collection and processing steps. To ensure eective DNA extraction and detect inhibitors that could interfere with amplification, sample process controls consisting of salmon DNA were added into the extraction buer as previously described (Shanks et al., 2016). Inhibition was measured by comparing the amplification eciency (i.e., cycle threshold) of the blanks compared with the samples. Internal amplification controls (Supplemental Table 1) were used to detect inhibition by comparing the cycle threshold of no-template List of Primers and Probes Used Assay Host Primer and Probe Group Reference TaqMan GenBac3 General Bacteroidetes F: GGGGTTCTGAGAGGAAGGT R: CCGTCATCCTTCACGCTACT P: [FAM]-CAATATTCCTCACTGCTGCCTCCCGTA-[TAMRA] Dick & Field, 2004; Siefring et al., 2008 HF183 Human F: ATCATGAGTTCACATGTCCG R: CTTCCTCTCAGAACCCCTATCC P1: [FAM]-CTAATGGAACGCATCCC-[MGB] P2: [VIC]-AACACGCCGTTGCTACA-[MGB] Bernhard & Field, 2000; Seurinck et al., 2005 HumM2 Human F: CGTCAGGTTTGTTTCGGTATTG R: TCATCACGTAACTTATTTATATGCATTAGC P1: [FAM]-TATCGAAAATCTCACGGATTAACTCTTGTGTACGC-[TAMRA] P2: [VIC]-CCTGCCGTCTCGTGCTCCTCA-[TAMRA] Shanks et al., 2009 Rum2Bac Ruminant F: ACAGCCCGCGATTGATACTGGTAA R: CAATCGGAGTTCTTCGTGAT P: [FAM]-ATGAGGTGGATGGAATTCGTGGTGT-[BHQ-1] Mieszkin et al., 2010 CowM2 Cattle F: CGGCCAAATACTCCTGATCGT R: GCTTGTTGCGTTCCTTGAGATAAT P: [FAM]-AGGCACCTATGTCCTTTACCTCATCAACTACAGACA-[TAMRA] Shanks et al., 2009 LA35 Poultry F: ACCGGATACGACCATCTGC R: TCCCCAGTGTCAGTCACAGC P: [FAM]-CAGCAGGGAAGAAGCCTTC GGGTGACGGTA-[BHQ-1] Nayak et al., 2015 DogBact Canine F: CGCTTGTATGTACCGGTACG R: CAATCGGAGTTCTTCGTG P: [6-FAM]-ATTCGTGGTGTAGC GGTGAAATGCTTAG-[BHQ-1] Schriewer et al., 2015 Sketa22 Quality assurance F: GGTTTCCGCAGCTGGG R: CCGAGCCGTCCTGGTCTA P: [FAM]-AGTCGCAGGCGGCCACCGT-[TAMRA] Haugland et al., 2005 SYBR Green GFD * General avian F: TCGGCTGAGCACTCTAGGG R: GCGTCTCTTTGTACATCCCA Green et al., 2012 GFC * Gull F: CCCTTGTCGTTAGTTGCCATCATTC R: GCCCTCGCGAGTTCGCTGC Green et al., 2012 * Assays were not successfully optimized. TABLE 1
December 2022 • Journal of Environmental Health 11 control wells in each plate with those containing samples or standards. Data Analysis and Interpretation Each run was assessed visually for performance using ABI 7500 Fast software. Runs were screened for amplification in negative controls, high standard deviation among replicates, successful amplification in positive controls, and a standard curve constructed from plasmids. For each plate that was considered a successful run, results were exported into Excel using ABI 7500 Fast software. Analysis of the results and graphics were produced using RStudio (2015 version). Results Quality Assurance and Controls Quality assurance and controls were implemented at various stages of the project to ensure the reliability of the data. Field blanks revealed no evidence of contamination at any stage of the sample handling process. The salmon DNA used as a control spike revealed environmental inhibition in all undiluted samples, which was addressed by a dilution factor of 5, after which no samples showed interference. Similarly, diluted samples showed no evidence of inhibition, as internal amplification controls were appropriately detected. Two assays failed to pass the screening for successful runs and indicated nonspecific amplification. Steps taken to optimize both the GFC and GFD assays (Table 1) failed to improve performance, resulting in nonspecific amplification or no amplification. Due to these failings, we did not include these assays in further analyses. General Indicators of Fecal Contamination Traditional monitoring for E. coli at the three watershed sites revealed the occurrence of elevated bacterial counts as defined by the Connecticut bathing beach standard of 104 CFU/100 ml (Table 2). The Lower Farm River had lower E. coli levels relative to the other locations, but still had elevated levels in 50% of the samples. E. coli levels at the Goodwives River exceeded regulatory limits in 75% of samples, while samples collected in Sasco Brook suggested impairment 67% of the time. E. coli levels were higher at both the Goodwives River and Sasco Brook in summer months, with samples in July and August exceeding 10,000 CFU/100 ml at one or both sites. The GenBac3 marker is found in members of the phylumBacteroidetes but is not associated with a specific host. Organisms from the phylumBacteroidetes such as E. coli are found in the gut of many animals, although the bacteria are also known to occur in the environment without contributions of fecal matter (Fiksdal et al., 1985). Like E. coli, the GenBac3 marker is an indicator of fecal contamination from multiple sources, and the two are often correlated (Bower et al., 2005; Savichtcheva et al., 2007). We found only a weak relationship, however, between E. coli and GenBac3 (Figure 2). We found a slightly higher correlation between the levels of E. coli and the general marker GenBac3 (R2 = .44) at Goodwives River. This correlation, however, is largely influenced by the elevated GenBac3 counts andE. coli levels in July and August, whereas there is little to no correlation when considering other samples from the same sites (R2 = .19) when high counts were removed from the analysis. Host-Specific Markers In addition to identifying general indicators of fecal bacteria, we also examined the presence of host-specific markers that provide information on the source of contamination Raw Counts Generated for the Two General Markers Quantified in the Three Targeted Watersheds Date Lower Farm River, Branford Goodwives River, Darien Sasco Brook, Westport E. coli Levels (CFU/100 ml) GenBac3 Counts (Markers/100 ml) E. coli Levels (CFU/100 ml) GenBac3 Counts (Markers/100 ml) E. coli Levels (CFU/100 ml) GenBac3 Counts (Markers/100 ml) 1/19/2016 12 346 14 320 54 3,024 2/16/2016 14 330 650 337 70 903 3/29/2016 190 1,568 38 153 52 558 4/26/2016 84 138 900 1,460 470 1,490 5/10/2016 80 94 82 47 74 455 6/23/2016 92 321 308 439 520 102 7/26/2016 168 369 22,000 1,248 1,100 401 8/22/2016 760 566 13,600 1,704 19,600 1,346 9/21/2016 140 208 1,200 301 300 194 10/18/2016 80 237 116 241 132 154 11/21/2016 350 490 138 133 350 1,940 12/19/2016 138 2,630 138 350 350 1,242 Note. The two general markers quantified in this study were not host associated. TABLE 2
12 Volume 85 • Number 5 A D VANC EME N T O F T H E SCIENCE (Table 1). We found little evidence of chronic human contamination at any site, although human markers were detected sporadically below the lower limit for quantification but still above the limit of detection (Supplemental Table 2). The ruminant marker was also detected infrequently at the Lower Farm River and Sasco Brook, while there was no detection at Goodwives River (Supplemental Table 1). The sporadic detection of markers at these sites does little to explain the sources of contamination, as the detection of these markers did not correspond to elevated counts of E. coli (Figure 3). Markers associated with contamination by poultry, dogs, and cattle feces were not detected in any of the samples (Supplemental Table 2). Discussion The aim of this project was to develop a microbial source tracking program in coastal Connecticut and establish a scientific method for assessing the sources of fecal contamination that can lead to water body impairment. This study, however, did not detect significant human, domesticated animal, or wildlife contributions to the elevated bacteria levels in the three targeted watersheds. Our results suggest that the tested sources might not contribute to the observed elevated bacteria levels. This information is valuable considering the potential threat to public health that the discovery of human markers would have represented. Not finding a definitive answer on the contamination source, however, prevents the development of actionbased remediation recommendations. While genetic markers associated with human, poultry, dog, ruminant, and cattle feces were successfully implemented, the markers for avian (including seagull) contamination failed quality assurance procedures. At the time of this study, alternative markers for avian contamination had not yet been tested for use in studies of this type. A more consistent and reliable marker for geese is needed as well as additional markers to enable the detection of other potential sources of bacterial contamination such as rodents or other wildlife. The U.S. Environmental Protection Agency, CT DEEP, and other agencies recognize that indicator bacteria are not the basis of a human health risk but rather a proxy for other more serious disease-causing organRelationship Between E. coli Levels and GenBac3 Counts in the Three Targeted Watersheds Note. The results demonstrate a weak correlation betweenE. coli levels and GenBac3 counts for any of the sampling sites. 1.0 1.5 2.0 2.5 1.0 3.0 4.0 2.0 2.5 3.0 3.5 4.0 2.0 2.5 3.0 2.0 2.0 2.5 3.0 3.5 2.5 3.0 2.0 1.5 A. Lower Farm River, Branford B. Goodwives River, Darien C. Sasco Brook, Westport Log10 GenBac3 (Markers/100 ml) Log10 GenBac3 (Markers/100 ml) Log10 GenBac3 (Markers/100 ml) Log10 E. coli (CFU/100 ml) Log10 E. coli (CFU/100 ml) Log10 E. coli (CFU/100 ml) FIGURE 2
December 2022 • Journal of Environmental Health 13 isms that might be present when indicator bacteria are detected at concentrations above the water quality criteria. While the results reported here support past findings by CT DEEP that all of these watersheds have had fecal contamination (State of Connecticut, 2022), the lack of correlation between E. coli levels and GenBac3 counts presents challenges in identifying sources of E. coli. As the elevated E. coli levels were predominantly in the summer, one possibility is that the E. coli originated from avian sources, particularly geese, which are known to have gut microbiota fluctuations resulting in elevated E. coli levels in summer months (Alderisio & DeLuca, 1999). Additionally, birds are known to have low levels of Bacteroidetes, further supporting the hypothesis that geese or other birds could have contributed E. coli while not adding to the levels of Bacteroidetes detected. Another possible explanation for the lack of correlation is that conditions were more favorable to support E. coli persistence outside of the gut environment in summer months when the water is warmer (Korajkic et al., 2019). While Bacteroidetes are anaerobic and thus do not survive outside the host gut for long regardless of the season (Ahmed et al., 2014; Ballesté & Blanch, 2010; Kreader, 1998), E. coli can persist outside the host for longer periods in specific environments (Ishii & Sadowsky, 2008). Limitations Our findings serve to not only advance the understanding of water quality in coastal Connecticut but also help to highlight the limitations of using molecular markers to identify sources of fecal contamination. Major limitations include the lack of correlation between indicators and pathogens (Korajkic et al., 2018) and an inadequate understanding of the persistence of traditional and newer fecal indicators (Korajkic et al., 2019). We also acknowledge the limitations of the tested DNA sources. The tested bird sources did not pass quality assurance, which—along with the fact that other nontested bacteria sources (e.g., rodents, etc.) might have been present in the sample—means that at this time it is not possible to correlate E. coli with bacteria-specific sources of bacterial contamination. Further research into source tracking as a means of determining public health risk is warranted. An additional or alternate direction for future studies could be to employ next-generation sequencing technologies to assess likely sources of bacteria and to detect actual pathogens rather than focusing on surrogate indicators. Moreover, a series of sampling points along each river in conjunction with a more aggressive sampling schedule that included precipitation events would have been the preferred collection methodology. Due to limited project resources, however, a single sample location was selected for each targeted watershed, with collections conducted in such a way as to avoid tidal influence. Conclusion This study confirmed past findings that the targeted watersheds were consistently aected by elevated levels of fecal contamination after a rainfall event as detected by the indicators E. coli and GenBac3. In addition, through the use of host-associated molecular markers used for microbial source tracking, we found no evidence to support the hypothesis that any of the sites were chronically impacted by human, ruminant (including cattle), poultry, or canine feces. Absence and Presence of Human-Associated (A) and RuminantAssociated (B) Markers in the Three Targeted Watersheds Note. The presence of the human-associated and ruminant-associated markers did not correlate with elevatedE. coli levels. Goodwives River Sasco Brook 1 2 3 4 1 2 3 4 Human Marker Jan 2016 Apr 2016 Jul 2016 Oct 2016 Jan 2016 Apr 2016 Jul 2016 Oct 2016 Jan 2016 Apr 2016 Jul 2016 Oct 2016 Jan 2016 Apr 2016 Jul 2016 Oct 2016 Jan 2016 Apr 2016 Jul 2016 Oct 2016 Jan 2016 Apr 2016 Jul 2016 Oct 2016 Absent Present Ruminant Marker Absent Present Lower Farm River, Branford B Log10 E. coli (CFU/100 ml) Log10 E. coli (CFU/100 ml) A Lower Farm River, Branford FIGURE 3
14 Volume 85 • Number 5 As more evidence mounts that E. coli levels are not necessarily associated with human health risks (Colford et al., 2007; Wade et al., 2010), it is important to bear in mind that elevated E. coli levels might not actually mean higher amounts of pathogens or feces. Future studies are necessary to address if the observed levels are associated with higher health risks and other indicators for fecal contamination. Additionally, other approaches to microbial source tracking—such as detecting viral markers through PCR amplification (Elkayam et al., 2018) or identifying chemical tracers (González-Fernández et al., 2021; Paruch & Paruch, 2021)—have been developed and could be used to complement the tools used in this study. More data regarding specific components of fecal contamination could provide additional information that would help determine sources that contribute to contamination and also assess the potential for human health risk. In addition to needing more reliable markers, this study highlights the importance of considering the properties of indicators when designing exploratory studies such as this one. As we used both live-culture and genetic markers to identify contamination, counts between these two dierent methods might have been more similar if samples had targeted flushes of fresh fecal contamination (e.g., after storm events). Collecting samples after a storm event could increase the chance of detecting fresh fecal matter, which would likely improve both the finding of a correlation between the general indicators and the detection of host-specific genetic markers that decay rapidly in the environment. Future studies should include more frequent water sampling associated with precipitation events and a more comprehensive sampling scheme to evaluate each watershed at multiple locations to pinpoint sources of contamination so that eective mitigation strategies can be instituted. DNA analysis can be an eective public health tool toward bacterial source identification that can aid in determining if source bacteria are a potential threat to public health and to guide remediation eorts. Further use of this technology should be evaluated, and its use considered by regulatory agencies as the DNA laboratory methodology is refined. Acknowledgements: This project was funded by CT DEEP through a CWA Section 319 Grant. Additional funding and in-kind services were provided by all authors. The authors would also like to extend a sincere thanks to Chris Malik of CT DEEP, Douglas Dingman of the Connecticut Agricultural Experiment Station, and Pete Fraboni of Earthplace for their valuable input throughout this water quality study. Corresponding Author: Michael A. Pascucilla, CEO/Director of Health, East Shore District Health Department, 688 East Main Street, Branford, CT 06405. Email: mpascucilla@esdhd.org. A D VANC EME N T O F T H E SCIENCE Ahmed, W., Gyawali, P., Sidhu, J.P.S., & Toze, S. (2014). Relative inactivation of faecal indicator bacteria and sewage markers in freshwater and seawater microcosms. Letters in Applied Microbiology, 59(3), 348–354. https://doi.org/10.1111/lam.12285 Alderisio, K.A., & DeLuca, N. (1999). Seasonal enumeration of fecal coliform bacteria from the feces of ring-billed gulls (Larus delawarensis) and Canada geese (Branta canadensis). Applied and Environmental Microbiology, 65(12), 5628–5630. https://doi.org/10.1128/ AEM.65.12.5628-5630.1999 Ballesté, E., & Blanch, A.R. (2010). Persistence of Bacteroides species populations in a river as measured by molecular and culture techniques. Applied and Environmental Microbiology, 76(22), 7608–7616. https://doi.org/10.1128/AEM.00883-10 Bernhard, A.E., & Field, K.G. (2000). A PCR assay to discriminate human and ruminant feces on the basis of host dierences in Bacteroides-Prevotella genes encoding 16S rRNA. Applied and Environmental Microbiology, 66(10), 4571–4574. https://doi.org/10.1128/ AEM.66.10.4571-4574.2000 Bower, P.A., Scopel, C.O., Jensen, E.T., Depas, M.M., & McLellan, S.L. (2005). Detection of genetic markers of fecal indicator bacteria in Lake Michigan and determination of their relationship to Escherichia coli densities using standard microbiological methods. Applied and Environmental Microbiology, 71(12), 8305–8313. https://doi.org/10.1128/AEM.71.12.8305-8313.2005 Cabral, J.P.S. (2010). Water microbiology. Bacterial pathogens and water. International Journal of Environmental Research and Public Health, 7(10), 3657–3703. https://doi.org/10.3390/ijerph7103657 Chern, E.C., Siefring, S., Paar, J., Doolittle, M., & Haugland, R.A. (2011). Comparison of quantitative PCR assays for Escherichia coli targeting ribosomal RNA and single copy genes. Letters in Applied Microbiology, 52(3), 298–306. https://doi. org/10.1111/j.1472-765X.2010.03001.x Colford, J.M., Jr., Wade, T.J., Schi, K.C., Wright, C.C., Griªth, J.F., Sandhu, S.K., Burns, S., Sobsey, M., Lovelace, G., & Weisberg, S.B. (2007). Water quality indicators and the risk of illness at beaches with nonpoint sources of fecal contamination. Epidemiology, 18(1), 27–35. https://doi.org/10.1097/01.ede.0000249425.329 90.b9 Dick, L.K., & Field, K. (2004). Rapid estimation of numbers of fecal Bacteroidetes by use of a quantitative PCR assay for 16S rRNA genes. Applied and Environmental Microbiology, 70(9), 5695–5697. https://doi.org/10.1128/AEM.70.9.5695-5697.2004 Elkayam, R., Aharoni, A., Vaizel-Ohayon, D., Sued, O., Katz, Y., Negev, I., Marano, R.B.M., Cytryn, E., Shtrasler, L., & Lev, O. (2018). Viral and microbial pathogens, indicator microorganisms, microbial source tracking indicators, and antibiotic resistance genes in a confined managed e®uent recharge system. Journal of Environmental Engineering, 144(3), Article 05017011. https://doi. org/10.1061/(ASCE)EE.1943-7870.0001334 References
December 2022 • our1al o) E18,ro1me1tal Healt+ 15 Fiksdal, L., Maki, J.S., LaCroix, S.J., & Staley, J.T. (1985). Survival and detection of Bacteroides spp., prospective indicator bacteria. Applied and Environmental Microbiology, 49(1), 148–150. https:// doi.org/10.1128/aem.49.1.148-150.1985 González-Fernández, A., Symonds, E.M., Gallard-Gongora, J.F., Mull, B., Lukasik, J.O., Rivera Navarro, P., Badilla-Aguilar, A., Peraud, J., Brown, M.L., Mora Alvarado, D., Breitbart, M., Cairns, M.R., & Harwood, V.J. (2021). Relationships among microbial indicators of fecal pollution, microbial source tracking markers, and pathogens in Costa Rican coastal waters. Water Research, 188, Article 116507. https://doi.org/10.1016/j.watres.2020.116507 Green, H.C., Dick, L.K., Gilpin, B., Samadpour, M., & Field, K.G. (2012). Genetic markers for rapid PCR-based identification of gull, Canada goose, duck, and chicken fecal contamination in water. Applied and Environmental Microbiology, 78(2), 503–510. https://doi.org/10.1128/AEM.05734-11 Harwood, V.J., Staley, C., Badgley, B.D., Borges, K., & Korajkic, A. (2014). Microbial source tracking markers for detection of fecal contamination in environmental waters: Relationships between pathogens and human health outcomes. FEMS Microbiology Reviews, 38(1), 1–40. https://doi.org/10.1111/1574-6976.12031 Haugland, R.A., Siefring, S.C., Wymer, L.J., Brenner, K.P., & Dufour, A.P. (2005). Comparison of Enterococcus measurements in freshwater at two recreational beaches by quantitative polymerase chain reaction and membrane filter culture analysis. Water Research, 39(4), 559–568. https://doi.org/10.1016/j.watres.2004.11.011 Haugland, R.A., Varma, M., Sivaganesan, M., Kelty, C., Peed, L., & Shanks, O.C. (2010). Evaluation of genetic markers from the 16S rRNA gene V2 region for use in quantitative detection of selected Bacteroidales species and human fecal waste by qPCR. Systematic and Applied Microbiology, 33(6), 348–357. https://doi. org/10.1016/j.syapm.2010.06.001 Ishii, S., & Sadowsky, M.J. (2008). Escherichia coli in the environment: Implications for water quality and human health. Microbes and Environments, 23(2), 101–108. https://doi.org/10.1264/ jsme2.23.101 Kildare, B.J., Leutenegger, C.M., McSwain, B.S., Bambic, D.G., Rajal, V.B., & Wuertz, S. (2007). 16S rRNA-based assays for quantitative detection of universal, human-, cow-, and dog-specific fecal Bacteroidales: A Bayesian approach. Water Research, 41(16), 3701– 3715. https://doi.org/10.1016/j.watres.2007.06.037 Korajkic, A., McMinn, B.R., & Harwood, V.J. (2018). Relationships between microbial indicators and pathogens in recreational water settings. International Journal of Environmental Research and Public Health, 15(12), Article 2842. https://doi.org/10.3390/ ijerph15122842 Korajkic, A., Wanjugi, P., Brooks, L., Cao, Y., & Harwood, V.J. (2019). Persistence and decay of fecal microbiota in aquatic habitats. Microbiology and Molecular Biology Reviews, 83(4), e0000519. https://doi.org/10.1128/MMBR.00005-19 Kreader, C.A. (1998). Persistence of PCR-detectable Bacteroides distasonis from human feces in river water. Applied and Environmental Microbiology, 64(10), 4103–4105. https://doi.org/10.1128/ AEM.64.10.4103-4105.1998 Mieszkin, S., Yala, J.-F., Joubrel, R., & Gourmelon, M. (2010). Phylogenetic analysis of Bacteroidales 16S rRNA gene sequences from human and animal e¥uents and assessment of ruminant faecal pollution by real-time PCR. Journal of AppliedMicrobiology, 108(3), 974–984. https://doi.org/10.1111/j.1365-2672.2009.04499.x National Environmental Methods Index. (n.d.). Standard methods: 9222D: Membrane filtration test for fecal coliforms. https://www. nemi.gov/methods/method_summary/5587/ Nayak, B., Weidhaas, J., & Harwood, V.J. (2015). LA35 poultry fecal marker persistence is correlated with that of indicators and pathogens in environmental waters. Applied and Environmental Microbiology, 81(14), 4616–4625. https://doi.org/10.1128/AEM.00444-15 Paruch, L., & Paruch, A.M. (2021). Cross-tracking of faecal pollution origins, macronutrients, pharmaceuticals and personal care products in rural and urban watercourses. Water Science & Technology, 83(3), 610–621. https://doi.org/10.2166/wst.2020.603 Pinckney, J.L., Paerl, H.W., Tester, P., & Richardson, T.L. (2001). The role of nutrient loading and eutrophication in estuarine ecology. Environmental Health Perspectives, 109(Suppl. 5), 699–706. https://doi.org/10.1289/ehp.01109s5699 Rabinovici, S.J.M., Bernknopf, R.L., Wein, A.M., Coursey, D.L., & Whitman, R.L. (2004). Economic and health risk trade-o§s of swim closures at a Lake Michigan beach. Environmental Science & Technology, 38(10), 2737–2745. https://doi.org/10.1021/ es034905z Save the Sound. (2022). Long Island Sound report card. https://www. savethesound.org/report-card Savichtcheva, O., Okayama, N., & Okabe, S. (2007). Relationships between Bacteroides 16S rRNA genetic markers and presence of bacterial enteric pathogens and conventional fecal indicators. Water Research, 41(16), 3615–3628. https://doi.org/10.1016/j. watres.2007.03.028 Schimmel, S.C., Benyi, S.J., & Strobel, C.J. (1999). An assessment of the ecological condition of Long Island Sound, 1990–1993. Environmental Monitoring and Assessment, 56(1), 27–49. https://doi. org/10.1023/A:1005967923353 Schriewer, A., Odagiri, M., Wuertz, S., Misra, P.R., Panigrahi, P., Clasen, T., & Jenkins, M.W. (2015). Human and animal fecal contamination of community water sources, stored drinking water and hands in rural India measured with validated microbial source tracking assays. The American Journal of Tropical Medicine and Hygiene, 93(3), 509–516. https://doi.org/10.4269/ajtmh.14-0824 Scott, T.M., Rose, J.B., Jenkins, T.M., Farrah, S.R., & Lukasik, J. (2002). Microbial source tracking: Current methodology and future directions. Applied and Environmental Microbiology, 68(12), 5796–5803. https://doi.org/10.1128/AEM.68.12.5796-5803.2002 References continued on page 16
www.neha.orgRkJQdWJsaXNoZXIy NTU5MTM=